English
Français

Database

Multiple Alignment

IDsAligned Sequences
Consensus structure

5'-.....<<<<<<<<<..<<<<<<...........................................................................

..........................................................................>>>>.>>.....<<<<<<........

.............................................................................>>>>>>....>>>>........<

<<<...<<<<<...................................>>>>>...>>>>.......>>>>>............-3'

 
RS003621 (Thermoplasma acidophilum)

5'-CUGGUGUGGUGGGGGAGCUCCAUA-------------------------------------------------------------------------

--------------------------------------------------------------------------AGGG-GCUGAGAGGAUCCGG------

---------------------------------------------------------------------------AUGGAUC-GA-UCCCUGGA----AC

CUGA-UCCGGGUAAU-------------------------------ACCGGCG-GAGG--GA--AAUUAUGGAAAAAAAUAG-3'

RS003622 (Thermoplasma acidophilum)

5'-AACUAGGCGAGGGGGAGCUCCAUA-------------------------------------------------------------------------

-------------------------------------------------------------------------AGGGG-GCUGAGAGGAUCCGG------

---------------------------------------------------------------------------AUGGAUCGA---CCCCUGGA---AC

CUGA-UCCGGGUAAU-------------------------------ACCGGCG-GAGG--GA--AUCGUAUGAUGAAUGAGA-3'

RS003623 (Corynebacterium diphtheriae)

5'-AGUGUCCCCCGCGGGCGCCCGAGC-------------------------------------------------------------------------

--------------------------------------------------------------------------ACGG-GCUGAGAUUGCGCUGAUGCU-

-----------------------------------------------------------------------------GUGCAAGCA-CCGUUUGA---AC

CUG--UCUGGUUAAC-------------------------------ACCAGCG-AAGG--AA--GAGAGGAGCGCGAGCCUA-3'

RS003624 (Corynebacterium diphtheriae)

5'-ACGAGAUGCCCGG-GUGCCAUGUGCUUGCUGU-----------------------------------------------------------------

-------------------------------------------------------------------------ACGUG-GCUGAGACGGCUGU-------

----------------------------------------------------------------------------UUGGCCGAA---CCGUAGA---AC

CUGA-UCUGGGUAAU-------------------------------ACCAGCGAUAGG--AA---GACUUCAUACUGUGACU-3'

RS003625 (Corynebacterium glutamicum ATCC 13032)

5'-AUACUAGGCACGGGGUGCCAACCGGAUGGAAAAAUUC------------------------------------------------------------

-------------------------------------------------------------------------CGGAG-GCUGAGAAA------------

----------------------------------------------------------------------------------ACA--CCCGUUGA---AC

CUGC-UCUAGCUCGU-------------------------------ACUAGCG-AAGG--GA---UGGCCUUAACGUGGCUA-3'

RS003626 (Corynebacterium diphtheriae)

5'-UUUAUAAAUCACGGGUGCUGGACGGCAUACGUUUGCC------------------------------------------------------------

-------------------------------------------------------------------------ACAAA-GCUGAGACAGGGCGAGAAGAC

GUGCAC----------------------------------------------------------------------GUCCCUGAA--CCGUUGA----AC

CUGA-UCCGGGUAAU-------------------------------ACCGGCGAUAGG--AA---GAAUAAUGAACCGAUCG-3'

RS003627 (Corynebacterium callunae)

5'-GGCAGUCCCCACGGGCGCCCGAGC-------------------------------------------------------------------------

--------------------------------------------------------------------------ACGG-GCUGAGAUCGCGCUGAUUSU-

----------------------------------------------------------------------------GCGCGAGCA--CCGUUUGA---AC

CUG--UCCGGUUAGC-------------------------------ACCGGCG-AAGG--AA--GAGAGGAAUGGUGCAAUG-3'

RS003628 (Mycobacterium leprae)

5'-ACUUCAGUACACGGGAGUCCCCAGGCAGUCCGAAUCU------------------------------------------------------------

-------------------------------------------------------------------------GCGGG-GCUGAGAGUGGGCACAGCCAG

AGUGACUGAAC----------------------------------------------------------------CUACCCUUA---CCCUCCCAC--AC

CUGA-UCCGGGUCAU-------------------------------GCCGGCG-AAGG--GA--GGUUCAAGAUGCCGUCAG-3'

RS003629 (Mycobacterium leprae)

5'-AAAAAACCACGCGGGAGCACACACCA-----------------------------------------------------------------------

-------------------------------------------------------------------------AGUGC-GCUGAGAGGACGGAUCGG---

---------------------------------------------------------------------------GGCCGUC-GA--CCGUAUGA---AC

CUGA--CCGGGUAAU-------------------------------GCCGGCG-UAGG--GA--GAUGAAUAAUGACUGAAA-3'

RS003630 (Mycobacterium avium subsp. paratuberculosis K-10)

5'-UCCAUCAGACGCGGGAGCGCACGCCA-----------------------------------------------------------------------

-------------------------------------------------------------------------AGUGU-GCUGAGAGGACGGCUCGG---

---------------------------------------------------------------------------GGCCGUC-GA--CCGUACGA---AC

CUGA--CCGGGUAAU-------------------------------GCCGGCG-UAGG--GA---GAUGAAAAAUGACCGCA-3'

RS003631 (Mycobacterium avium subsp. paratuberculosis K-10)

5'-CGUUUUAGACACGGGAGUCCCGGGAC-----------------------------------------------------------------------

-------------------------------------------------------------------------CGGGG-UCUGAGAGUGGGCGCGC----

---------------------------------------------------------------------------CCGCCCUUA---CCGUCAC----AC

CUGA-UCCGGAUCAU-------------------------------GCCGGCG-AAGG--GA---GGCCGCGAAUGCCCUCG-3'

RS003632 (Mycobacterium tuberculosis H37Rv)

5'-CCCUGUAGACACGGGAGUCCCGGGAG-----------------------------------------------------------------------

-------------------------------------------------------------------------CGGGG-UCUGAGAGUGGGCGCGC----

---------------------------------------------------------------------------CUGCCCUUA---CCGUCAC----AC

CUGA-UCCGGAUCAU-------------------------------GCCGGCG-AAGG--GA--GGUCAAGGAUGGCGUCCG-3'

RS003633 (Mycobacterium tuberculosis H37Rv)

5'-GGGUACCCACGCGGGAGCGCACGCCG-----------------------------------------------------------------------

-------------------------------------------------------------------------AGUGC-GCUGAGAGGACGGCUCGG---

---------------------------------------------------------------------------GGCCGUC-GA--CCGUACGA---AC

CUGA--CCGGGUAAU-------------------------------GCCGGCG-UAGG--GA---GUUGCAAAUGACCAUCA-3'

RS003634 (Mycobacterium tuberculosis)

5'-GGGUACCCACGCGGGAGCGCAACGCCG----------------------------------------------------------------------

-------------------------------------------------------------------------AGUGC-GCUGAGAGGACGGCUCGG---

---------------------------------------------------------------------------GGCCGUC-GA--CCGUACGA---AC

CUGA--CCGGGUAAU-------------------------------GCCGGCG-UAGG--GA---GUUGCAAAUGACCAUCA-3'

RS003635 (Streptomyces coelicolor)

5'-CUUUGUACACGCGGGAGCUCGGAGC------------------------------------------------------------------------

-------------------------------------------------------------------------ACCGG-GCUGAGAGGGCGCUGACCUCC

GUCCCAGCGAUGUUUCACGGGAAACGUCACCGAAGUCGAGUGACGUAUCCCACGAAGCGUCGACGGACGGAAGCCGCUGCGUCGA--CCGCCGA----AC

CUGUUACCGGGUAAU-------------------------------GCCGGCG-UAGG--GA---GUAGGUCUCAUGACCAU-3'

RS003636 (Streptomyces coelicolor)

5'-AUAUUCCGACAGGGGAGCGCCA---------------------------------------------------------------------------

--------------------------------------------------------------------------CAGC-GCUGAGAGUGCGGCACC----

---------------------------------------------------------------------------GGCCGCA-GA--CCCUCCGA---AC

CUGG-CCCAGGUCAU-------------------------------UCUGG-G-UAGG--GA--GAUCGGUCACCACUCGAG-3'

RS003637 (Streptomyces coelicolor)

5'-CAAGGCACUCGCGGGAGCCCGGACGC-----------------------------------------------------------------------

-------------------------------------------------------------------------ACCGG-GCUGAGAGGGAGGCUGGC---

----------------------------------------------------------------------------GGCCUCCGA--CCGUACGA---AC

CUGA-UCCGGGUCAU-------------------------------GCCGGCG-AAGG--GA---GGGGCUGGACGCCCAUG-3'

RS003638 (Bacteroides thetaiotaomicron VPI-5482)

5'-UUCACUAAGUAGGGGUGCCUUAACAU-----------------------------------------------------------------------

-------------------------------------------------------------------------GACGG-GCUGAGAAC------------

----------------------------------------------------------------------------------AUA--CCCAUAGA---AU

CUGA-ACCGGGUAAU-------------------------------GCCGGCG-UAGA--GA---ACUAAUUAAUAAGCAAG-3'

RS003639 (Bacteroides thetaiotaomicron VPI-5482)

5'-GUAAAGACAAAGGGGUGCCCCCAAA------------------------------------------------------------------------

-------------------------------------------------------------------------GAGGG-GCUGAGAUU------------

----------------------------------------------------------------------------------AUA--CCCUAGGA---AC

CUGA-GGCAGUUAGC-------------------------------ACUGACG-UAGG--GA---UUGUGUUUCUUUCUUAU-3'

RS003640 (Bacteroides thetaiotaomicron VPI-5482)

5'-UUCACGCAAUAGGGGUGCCCUAACAU-----------------------------------------------------------------------

-------------------------------------------------------------------------GACAG-GCUGAGAAC------------

----------------------------------------------------------------------------------AUA--CCCAUAGA---AU

CUGA-UCCGGGUAAU-------------------------------GCCGGCG-UAGA--GA---ACGAAUAAAUAAGCAAA-3'

RS003641 (Porphyromonas gingivalis W83)

5'-AAUUGGGAGAAGGGGUGCUUCCUGUAGCAAUCGGAAUGCGU--------------------------------------------------------

-------------------------------------------------------------------------GGAUG-GCUGAGAAC------------

----------------------------------------------------------------------------------AAA--CCCUCAUC---AC

CUGA-ACCGGAUAAU-------------------------------ACCGGCG-UAGG--AA-ACUCUCCGUCUGACUAUCU-3'

RS003642 (Porphyromonas gingivalis W83)

5'-AGACCGCUACGGGGGUGCUUGCCGGCAAGAAUUGCGAUAC---------------------------------------------------------

-------------------------------------------------------------------------GGCAG-GCUGAGAUA------------

----------------------------------------------------------------------------------AUA--CCCAUAG----AC

CUGA-UCCGGAUAAU-------------------------------ACCGGCG-GAGG--GA--UGUAGAAUCGAAUACACA-3'

RS003643 (Synechococcus sp. WH 8102)

5'-AAACACCACUAGGGGUGCCUCGAUCGGUUUUCUGGUCG-----------------------------------------------------------

-------------------------------------------------------------------------ACGGG-GCUGAGAUC------------

----------------------------------------------------------------------------------ACA--CCCUCUGA---AC

CUGA-CCCGGGUCAU-------------------------------GCCGGCG-AAGG--GA---AGUGACCAGCGUGAUCG-3'

RS003644 (Prochlorococcus marinus subsp. pastoris str. CCMP1986)

5'-AAAUAUAACUAGGGGUGCUAAGUCAAUU---------------------------------------------------------------------

-------------------------------------------------------------------------ACUUA-GCUGAGAUC------------

----------------------------------------------------------------------------------AUA--CCCUUCGA---AC

CUGA-AACAGUUAAA-------------------------------ACUGACG-CAGG--AA---AGUUUCAAUUUGAUCGA-3'

RS003645 (Prochlorococcus marinus subsp. marinus str. CCMP1375)

5'-AAAUAUCACUAGGGGUGCCUACAAGCUAUUGC-----------------------------------------------------------------

-------------------------------------------------------------------------UUUUG-GCUGAGAUC------------

----------------------------------------------------------------------------------ACA--CCCUCUGA---AC

CUGA-UUCGGUUUAU-------------------------------ACCGUCG-AAGG--AA---AGUGAAAGAGAGUGAUC-3'

RS003646 (Prochlorococcus marinus str. MIT 9313)

5'-GCAAAACACUAGGGGUGCCAUUCAGCAAUCGCU----------------------------------------------------------------

-------------------------------------------------------------------------GAGUG-GCUGAGAUC------------

----------------------------------------------------------------------------------ACA--CCCUCCGA---AC

CUGA-UACGGGUUGU-------------------------------GCCGGCG-CAGG--GA---AGUGAAAUGACGUGAUC-3'

RS003647 (Deinococcus radiodurans R1)

5'-UCGCGUCACCGGGGGUGCCCUGCUUCGG---------------------------------------------------------------------

-------------------------------------------------------------------------CAGCG-GCUGAGAAC------------

----------------------------------------------------------------------------------ACA--CCCCAGGA---AC

CUGA-ACCGGGUCAU-------------------------------UCCGGCG-GAGG--GA--GUGUGAUGCUCUGCUCCG-3'

RS003648 (Deinococcus radiodurans R1)

5'-CAUCGUCAACAGGGGUGCCUCCGCAUAUGGGC-----------------------------------------------------------------

-------------------------------------------------------------------------CGGAG-GCUGAGAGGGCAACU------

----------------------------------------------------------------------------CGGGCCUAA--CCCUAUGA---AC

CUGA-ACUGGUUAGC-------------------------------ACCAGCG-GAGG--GA--GUGUGACGGGCGCAGAGA-3'

RS003649 (Bacillus subtilis)

5'-GAUGACCACAAGGGGAGCAUU----------------------------------------------------------------------------

---------------------------------------------------------------------------AAA-GCUGAGAGUGAGCGGUU----

---------------------------------------------------------------------------UCGUUC-UGA--CCCUUUGA---AC

CUG--U-UAGUUAAC-------------------------------GCUGGCG-UAGG--GA---UGUGGCAAAUGCAAUAG-3'

RS003650 (Bacillus subtilis subsp. subtilis str. 168)

5'-GAUUCAUCCUAGGGGUGCUUUG---------------------------------------------------------------------------

--------------------------------------------------------------------------CGAA-GCUGAGAGAGACU--------

----------------------------------------------------------------------------UUGUCUCAA--CCCUUUUG---AC

CUGA-UCUGGAUCAU-------------------------------GCCAGCG-GAGG--GA---AGCGGUGAAAAGCGGAG-3'

RS003651 (Bacillus subtilis subsp. subtilis str. 168)

5'-GAUGACCACAAGGGGAGCAUU----------------------------------------------------------------------------

---------------------------------------------------------------------------AAA-GCUGAGAGUGAGCGGUU----

----------------------------------------------------------------------------UCGUUCUGA--CCCUUUGA---AC

CUG--U-UAGUUAAC-------------------------------GCUGGCG-UAGG--GA---UGUGGCAAAGUCAAAUG-3'

RS003652 (Bacillus methanolicus)

5'-AAAAAACUAUUAGGGUGCCCGUAG-------------------------------------------------------------------------

-------------------------------------------------------------------------UAUGG-GUUUAGAAA------------

----------------------------------------------------------------------------------AAA--CCUUUUGG---AC

UUGA-UAUGGAUCAU-------------------------------ACCAGCU-UAGG--AA--AGUAGUGUAAUUUUUUCC-3'

RS003653 (Bacillus subtilis)

5'-AAUAGUUACUGGGGGUGCCCGCUU-------------------------------------------------------------------------

--------------------------------------------------------------------------UCGG-GCUGAGAGAGAAGGCAA----

----------------------------------------------------------------------------GCUUCUUAA--CCCUUUGG---AC

CUGA-UCUGGUUCGU-------------------------------ACCAGCG-UGGG--GA---AGUAGAGGAAUUGUUUU-3'

RS003654 (Bacillus subtilis subsp. subtilis str. 168)

5'-UUUAACCACUAGGGGUGUCCUUCA-------------------------------------------------------------------------

-------------------------------------------------------------------------UAAGG-GCUGAGAUAAAAGUGUG----

----------------------------------------------------------------------------ACUUUUAGA--CCCUCAUA---AC

UUGA-ACAGGUUCAG-------------------------------ACCUGCG-UAGG--GA---AGUGGAGCGGUAUUUGU-3'

RS003655 (Bacillus firmus)

5'-UAGUUCCACUAGGGGUGUCAGUUU-------------------------------------------------------------------------

-------------------------------------------------------------------------GUCUG-ACUGAGAGAGGGA--------

-----------------------------------------------------------------------------AGCCUCAA--CUCUUAAA---AC

CUGA-UCUAGCUUGU-------------------------------ACUAGCG-UAGG--GA---AGUGGUGGCACAUUCUA-3'

RS003656 (Bacillus subtilis)

5'-GGAAAGCACUAGGGGUGCUGU----------------------------------------------------------------------------

--------------------------------------------------------------------------UUUG-GCUGAGAUAAAGCGCGGAAGA

AACG------------------------------------------------------------------------CGCUUUGAU--CCCUUAUG---AC

CCGA-UCUGGAUAAU-------------------------------ACCAGCG-UGGG--GA---AGUGCAGGUUGACCGAA-3'

RS003657 (Bacillus subtilis)

5'-UUUAACCACUAGGGGUGUCCUUCA-------------------------------------------------------------------------

-------------------------------------------------------------------------UAAGG-GCUGAGAUAAAAGUGUG----

----------------------------------------------------------------------------ACUUUUAGA--CCCUCAUA---AC

UUGA-ACAGGUUCAG-------------------------------ACCUGCG-UAGG--GA---AGUGGAGCGUAUUUGUG-3'

RS003658 (Bacillus cereus group.Viruses.Viruses.Viruses.Viruses)

5'-UGAAACCACUAGGGGUGCUUG----------------------------------------------------------------------------

--------------------------------------------------------------------------UUGU-GCUGAGAGAGGAAU-------

----------------------------------------------------------------------------AAUCCUUAA--CCCUUAUAAC-AC

CUGA-UCUAGGUAAU-------------------------------ACUAGCG-AAGG--GA---AGUGGAACAACGAAUAA-3'

RS003659 (Bacillus phage phBC6A52)

5'-AAUUAAGGACCGGGGAGCCAA----------------------------------------------------------------------------

---------------------------------------------------------------------------UUG-GCUGAGAGGAUGUAAGU----

---------------------------------------------------------------------------AAACAUC-GA--CCCUCA-----AC

CUGA-UCUGGAUAAU-------------------------------GCCAGCG-UAGG--GA--GUUACUUAAAGUGAUGUA-3'

RS003660 (Bacillus cereus group.Viruses.Viruses.Viruses.Viruses)

5'-AAUAAGCAC-AUGGGAGUUUGUGGA------------------------------------------------------------------------

-------------------------------------------------------------------------UGCAA-ACUGAGAGUAUGACUAUUC--

---------------------------------------------------------------------------CGUCAU-UGA--CCAUUUGA---AC

CUG--U-UGGAUAAU-------------------------------GCCAGCG-UAGG--GA--GAGUGUAAAAGCACAUGU-3'

RS003661 (Bacillus phage phBC6A52)

5'-UAAGAAACACAUGGGAGUUUGUGGA------------------------------------------------------------------------

-------------------------------------------------------------------------UACAA-ACUGAGAGUAUGGCUACUAGU

C--------------------------------------------------------------------------CGUCAU-UGA--CCAUUUGA---AC

CUG--U-UGGAUAAU-------------------------------GCCAGCG-UAGG--GA-GAGUGUAAAAGCACAUAUU-3'

RS003662 (Bacillus phage phBC6A52)

5'-CGUUAUCACUGGGGGAGCCAU----------------------------------------------------------------------------

---------------------------------------------------------------------------GCC-GCUGAGAGGGAACACU-----

---------------------------------------------------------------------------UCGUUCC-GA--CCCUUCGA---AC

CUG---UUAGUUAAU-------------------------------GCUAACG-CAGG--GA--UUGUGCAAACGUCCGAAA-3'

RS003663 (Bacillus phage phBC6A52)

5'-AUAGUUUGCUAGGAGAGCUGGUGU-------------------------------------------------------------------------

-------------------------------------------------------------------------UGCCA-GCUGAGAGUAGGCCGUA----

----------------------------------------------------------------------------AGCCUUUGA--UCCUUUUUAUUAC

CUGA-UCUAGAUUAU-------------------------------GCUAGCG-UAGG--GA---AGCAAUUCGGACACUAA-3'

RS003664 (Bacillus phage phBC6A52)

5'-UGAAACCACUAGGGGUGCUUG----------------------------------------------------------------------------

--------------------------------------------------------------------------ACUU-GCUGAGAGAGGAAU-------

----------------------------------------------------------------------------AAUCCUUAA--CCCUUACAAC-AC

CUGA-UCUAGGUAAU-------------------------------ACUAGCG-AAGG--GA---AGUGGAACAUCGAAUAA-3'

RS003665 (Bacillus cereus group.Viruses.Viruses.Viruses.Viruses)

5'-AAUUAAGGACCGGGGAGCCAA----------------------------------------------------------------------------

---------------------------------------------------------------------------UUG-GCUGAGAGGAUGUGAGC----

---------------------------------------------------------------------------AAACAUC-GA--CCCUCA-----AC

CUGA-UCUGGAUAAU-------------------------------GCCAGCG-UAGG--GA--GUUACUUAAAGUAAUGUA-3'

RS003666 (Bacillus phage phBC6A52)

5'-UUCAUCCACUAGGGGGGCCUUUU--------------------------------------------------------------------------

--------------------------------------------------------------------------AUAG-GCUGAGAUCAAAUGUG-----

----------------------------------------------------------------------------AUUUUGAGA--CUCUUAGU---AC

CUGA-UCUGGUUAAU-------------------------------GCCAGCG-UAGG--GA---AGUGGGAAAGACGUUGC-3'

RS003667 (Bacillus cereus group.Viruses.Viruses.Viruses.Viruses)

5'-GUGAUAAACUAGGGGUGCCUAACGUAUG---------------------------------------------------------------------

-------------------------------------------------------------------------CGUAG-GCUGAGAGAGAAGCGCGUAA-

----------------------------------------------------------------------------ACUUCUUAA--CCCUUUGG---AC

CUGA-UCUGGCUCGU-------------------------------ACCAGCG-UAGG--GA---AGUUAACGGCUUUACAU-3'

RS003668 (Bacillus cereus ATCC 10987)

5'-GUGAUAAACUAGGGGUGCCUAACGUAUG---------------------------------------------------------------------

-------------------------------------------------------------------------CGUAG-GCUGAGAGAGAAGCGCGUGA-

----------------------------------------------------------------------------ACUUCUUAA--CCCUUUGG---AC

CUGA-UCUGGCUCGU-------------------------------ACCAGCG-UAGG--GA---AGUUAACGGCUUUACAU-3'

RS003669 (Bacillus cereus ATCC 10987)

5'-UACUAAACACAUGGGAGUUUGUGGA------------------------------------------------------------------------

-------------------------------------------------------------------------UACAA-ACUGAGAGUAUGACUAGUC--

---------------------------------------------------------------------------CGUCAU-UGA--CCAUUUGA---AC

CUG--U-UGGAUAAU-------------------------------GCCAGCG-UAGG--GA-GAGUGUAAAAGCACAUGUU-3'

RS003670 (Bacillus cereus ATCC 10987)

5'-AAUUAAGGACCGGGGAGCCAA----------------------------------------------------------------------------

---------------------------------------------------------------------------UUG-GCUGAGAGGAUGUGAGU----

---------------------------------------------------------------------------AAACAUC-GA--CCCUCA-----AC

CUGA-UCUGGAUAAU-------------------------------GCCAGCG-UAGG--GA--GUUACUUAAAGUGAUGUA-3'

RS003671 (Bacillus cereus ATCC 10987)

5'-CGUUAUCACAGGGGGAGCCAU----------------------------------------------------------------------------

---------------------------------------------------------------------------GCC-GCUGAGAGGGAACACU-----

----------------------------------------------------------------------------UCGUUCCGA--CCCUUCGA---AC

CUG---UUAGUUAAU-------------------------------GCUAACG-CAGG--GA--UUGUGCAAACGUCCGAAA-3'

RS003672 (Bacillus cereus ATCC 10987)

5'-AUAGUUUGCUAGGAGAGCUGGUGU-------------------------------------------------------------------------

-------------------------------------------------------------------------UGCCA-GCUGAGAGUAAGGCCUUA---

---------------------------------------------------------------------------AGUCUUUGA---UCCUUUUUAUUAC

CUGA-UCUAGAUUAU-------------------------------GCUAGCG-UAGG--GA---AGCAAUUCGGACACUAA-3'

RS003673 (Bacillus cereus ATCC 10987)

5'-UUUAUCCACUAGGGGGGCCUAUU--------------------------------------------------------------------------

--------------------------------------------------------------------------AUAG-GCUGAGAUCAAAUUGG-----

----------------------------------------------------------------------------AAUUUGAGA--CUCUUAGU---AC

CUGA-UCUGGUUAAU-------------------------------GCCAGCG-UAGG--GA---AGUGGGAAAGACAUUGC-3'

RS003674 (Bacillus cereus ATCC 10987)

5'-UGAAACCACUAGGGGUGCUUG----------------------------------------------------------------------------

--------------------------------------------------------------------------UUGU-GCUGAGAGAGGAAU-------

----------------------------------------------------------------------------AAUCCUUAA--CCCUUACAG--AC

CUGA-UCUAGGUAAU-------------------------------ACUAGCG-AAGG--GA---AGUGGAGCAACGAAUAA-3'

RS003675 (Listeria monocytogenes)

5'-CGUUACCACAGGGGGGGCUUC----------------------------------------------------------------------------

---------------------------------------------------------------------------UUA-GCUGAGAUUGAGUCCACGUGU

UUUU-----------------------------------------------------------------------GGAUUCUGA---CCCUUUGA---AC

CUGU-UC--GUUAAU-------------------------------ACGAGCG-UAGG--GA--UUGUGGCGAUUGCAUUUC-3'

RS003676 (Listeria innocua)

5'-CGUUACCACAGGGGGGGCUUC----------------------------------------------------------------------------

---------------------------------------------------------------------------UUA-GCUGAGAUUGAAUCCGCGUGU

UUUU-----------------------------------------------------------------------GGAUUCUGA--CCCUUUGA----AC

CUGU-UC--GUUAAU-------------------------------ACGAGCG-UAGG--GA--UUGUGGCGAUUGCAUUUC-3'

RS003677 (Listeria innocua)

5'-AAGAAAAACUAGGGGGGCCGAU---------------------------------------------------------------------------

--------------------------------------------------------------------------UCUG-GCUGAGAUAGGAAGGUAAU--

---------------------------------------------------------------------------GCUUUCUGA---CCCUUUGA---AC

CUG--U-UUGUUAGU-------------------------------GCAAGCG-UAGG--GA---AGUGAAUGUGAAAGUGA-3'

RS003678 (Staphylococcus epidermidis ATCC 12228)

5'-UAGUAUCACUAGGGGUGCAAUUCA-------------------------------------------------------------------------

--------------------------------------------------------------------------AUUU-GCUGAGAGAAAGUC-------

----------------------------------------------------------------------------UACUUUCAA--CCCUUGA----AC

CUG--U-UGGUUAGC-------------------------------ACCGGCG-UAGG--AA---AGUGAGCAAUAUUGAUA-3'

RS003679 (Staphylococcus epidermidis)

5'-UAGUAUCAUUAGGGGUGCAAUUCA-------------------------------------------------------------------------

--------------------------------------------------------------------------AUUU-GCUGAGAGAAAGUC-------

----------------------------------------------------------------------------UACUUUCAA--CCCUUGA----AC

CUG--U-UGGUUAGC-------------------------------ACCAGCG-UAGG--AA---AGUGAGCAAUAUUGAUA-3'

RS003680 (Staphylococcus epidermidis)

5'-AUUUGCUACUAGGGGAGCCAA----------------------------------------------------------------------------

---------------------------------------------------------------------------AAG-GCUGAGAUGAAUG--------

-----------------------------------------------------------------------------UAUUCAGA--CCCUUAUA---AC

CUGA-UUUGGUUAAU-------------------------------ACCAACG-UAGG--AA---AGUAGUUAUUAACUAUU-3'

RS003681 (Staphylococcus epidermidis ATCC 12228)

5'-UGAACGCACUAGGGGUGUAUU----------------------------------------------------------------------------

--------------------------------------------------------------------------CUUU-ACUGAGAUGAGGCC-------

----------------------------------------------------------------------------AACCUCAAA--CCCUUCGA---AC

CUGA-UCUAGCUAGUU------------------------------ACUAGCG-UAGG--AA---AGUGUUGUUAUACAUCU-3'

RS003682 (Staphylococcus epidermidis ATCC 12228)

5'-UAUAUGCACUAGGGGUGUUUU----------------------------------------------------------------------------

---------------------------------------------------------------------------UUA-ACUGAGAUGGAUA--------

----------------------------------------------------------------------------UCAUCCAAA--CCCUUUGA---AC

CUGA-ACUAGCUUAU-------------------------------ACUAGCG-GAGG--AA---AGUGUUGAAUCUCAUCU-3'

RS003683 (Staphylococcus epidermidis ATCC 12228)

5'-UUUAACCACUGGAAGUGCCUUUGU-------------------------------------------------------------------------

-------------------------------------------------------------------------UUAAG-GCUGAGAGUAAAGAACUG---

----------------------------------------------------------------------------ACUUUAUAA--UUCCUGGA---AC

CUGA-UCCAGUUCAU-------------------------------ACUGGCG-UAGG--GA---AGUGGCGACGCUCAAUU-3'

RS003684 (Staphylococcus carnosus)

5'-UAAAAUUGCUAGGGGCGCCUU----------------------------------------------------------------------------

---------------------------------------------------------------------------UUG-GCUGAGAUAGUUU--------

------------------------------------------------------------------------------GACUAGA--CCCUUAUA---AC

CUGA-UUUGGUUCGU-------------------------------ACCAACG-UAGG--AA---AGUAGUAUAUUCAGAAU-3'

RS003685 (Clostridium tetani E88)

5'-AAAUAAAUUUAGGGGAGCUUAUAAA------------------------------------------------------------------------

-------------------------------------------------------------------------AAUAG-GCUGAGAAAGAGAUGU-----

---------------------------------------------------------------------------UAUCUCUGA---CCCUCAUA---AC

CUGA-UUUGGCUAAU-------------------------------ACCAACG-UAGG--GA---ACAUUGUGUAUUGUAGU-3'

RS003686 (Clostridium acetobutylicum ATCC 824)

5'-AAUAUUUUUCAGGGGAGCUUGUUU-------------------------------------------------------------------------

--------------------------------------------------------------------------UCAG-GCUGAGAGGAAGUAAUU----

----------------------------------------------------------------------------GAACUUCGA--UCCAUAU----AC

CUGA-UUUGGAUAAU-------------------------------GCCAACG-UAGG--AA---AUAGGUUACUUGAUUUA-3'

RS003687 (Clostridium acetobutylicum ATCC 824)

5'-UUUUAGUGCUAGGGGUGCCUU----------------------------------------------------------------------------

---------------------------------------------------------------------------UUG-GCUGAGAGAAGUUAAA-----

----------------------------------------------------------------------------AAACUUUAA--CCCUUUGA---AC

CUGA-UUCGGUUAAU-------------------------------UCUGACG-AAGG--AA---AGCUUUUUAAAUGAUUA-3'

RS003688 (Clostridium acetobutylicum ATCC 824)

5'-AUAUAGUUAACGGGGAGCCUGUAG-------------------------------------------------------------------------

--------------------------------------------------------------------------ACAG-GCUGAGAGUGGAAUGU-----

---------------------------------------------------------------------------GAUUCCA-GA--CCCUCAUA---AC

CUGA-UUUGGAUAAU-------------------------------GCCAACG-UAGG--GA--GUUAAUGCAUCAUGUUUG-3'

RS003689 (Clostridium acetobutylicum ATCC 824)

5'-UAUUUUAGCUAGGGGUGCCUUUUAAGGCUUUUAUAGUUGAUAUCAUUAAAAAUAUUUAACUAAUAAAAGAC--------------------------

-------------------------------------------------------------------------UUUAG-GCUGAGAGGAGA---------

------------------------------------------------------------------------------AAUCCAA--CCCUUUGA---AC

UUGA-UGUAGUUAAU-------------------------------ACUACCG-UAGG--GA---AGCAGUGCAUUGUAUAU-3'

RS003690 (Clostridium tetani E88)

5'-AUAAAGUUUCAGGGGAGCUGGUUUA------------------------------------------------------------------------

-------------------------------------------------------------------------UGUCA-GCUGAGAGUAAGAACUAA---

----------------------------------------------------------------------------AUUCUUAGA--CCCUUUA----AC

CUGA-UCUGGAUAAU-------------------------------GCCAGCG-UAGG--GA---GAUGGUUUACUAUAUAA-3'

RS003691 (Clostridium acetobutylicum ATCC 824)

5'-UAUAUGUGCUAGGGGUGCCUU----------------------------------------------------------------------------

---------------------------------------------------------------------------UAG-GCUGAGAAACAGUUUG-----

----------------------------------------------------------------------------UCACGUUAA--CCCUUA-----AC

CUGA-UCUGGAUAAU-------------------------------ACCAGCG-UAGG--GA---AGCAGUU-----------3'

RS003692 (Clostridium tetani E88)

5'-AUGUAGUGCUAGGGGUGCUAUAU--------------------------------------------------------------------------

--------------------------------------------------------------------------AAGA-GCUGAGAAAUGAAUUAUUUAU

GAUCA-----------------------------------------------------------------------AUUCAUUAA--CCCUUGU----AC

CUGA-ACUAGAUAAU-------------------------------UCUAGCG-UAGG--GA---AGCCUUUUAUAGAUAUA-3'

RS003693 (Thermoanaerobacter tengcongensis MB4)

5'-UCAAAGUGCUAGGGGAGCCAGA---------------------------------------------------------------------------

--------------------------------------------------------------------------AAUG-GCUGAGAGGGGAUU-------

----------------------------------------------------------------------------CGUUCCCGA--CCCUUAGA---AC

CUGA-CCAGGGUAAU-------------------------------GCCUGCG-AAGG--GA---AGCACGUUUUACGGAAU-3'

RS003694 (Thermoanaerobacter tengcongensis MB4)

5'-UAUGUCCGCUGGGGGAGCCUGA---------------------------------------------------------------------------

--------------------------------------------------------------------------AAAG-GCUGAGACGGCAGA-------

----------------------------------------------------------------------------AAUGCCGAA--CCCUUGGA---AC

CUGA-UGAGGGUAAU-------------------------------GCCUCCG-UAGG--GA--AUGCGGGCUCAAAAGGCA-3'

RS003695 (Thermoanaerobacter tengcongensis MB4)

5'-CUCAAGUGCUAGGGGAGCCAAA---------------------------------------------------------------------------

--------------------------------------------------------------------------AAUG-GCUGAGAGGGGAUU-------

----------------------------------------------------------------------------CGUUCCCGA--CCCUUAGA---AC

CUGA-CCAGGGUAAU-------------------------------GCCUGCG-AAGG--GA---AGCACGUUUUACGAAAU-3'

RS003696 (Thermoanaerobacter tengcongensis MB4)

5'-CUCAAGUGCUAGGGGAGCCAGA---------------------------------------------------------------------------

--------------------------------------------------------------------------AAUG-GCUGAGAGGGGAUU-------

----------------------------------------------------------------------------CGUUCCCGA--CCCUUAGA---AC

CUGA-CCAGGGUAAU-------------------------------GCCUGCG-AAGG--GA---AGCACGUUUUAUUGAGU-3'

RS003697 (Enterococcus faecalis V583)

5'-AAAAAACAUUUGGGGUGCUGU----------------------------------------------------------------------------

--------------------------------------------------------------------------UAUG-GCUGAGAU-------------

---------------------------------------------------------------------------------GAUA--CCCAUUGA---AC

CUGA-UGCAGUUAGU-------------------------------ACUGUCG-CAGG--GA---AAUGCCGAUUUACUUUG-3'

RS003698 (Enterococcus faecalis V583)

5'-GAGAAACAUUUGGGGUGCUA-----------------------------------------------------------------------------

---------------------------------------------------------------------------UUA-GCUGAGAUU------------

----------------------------------------------------------------------------------AUA--CCCAUGGA---AC

CUGA-AACAGUUAGG-------------------------------ACUGGCG-CAGG--GA---AAUGUCUUGAAAUUUUG-3'

RS003699 (Siphoviridae)

5'-UAAAUACAUCUGGGGUGCCUA----------------------------------------------------------------------------

--------------------------------------------------------------------------UCGG-GCUGAGAAU------------

----------------------------------------------------------------------------------AUA--CCCAUUGA---AC

CUG--UUUGAUUAAU-------------------------------AUCAGCG-UAGG--GA--AAAUGACUAUUUUUAGAC-3'

RS003700 (Lactobacillus plantarum WCFS1)

5'-UCAUAGCAACUGGGGUGCCAU----------------------------------------------------------------------------

--------------------------------------------------------------------------CACG-GCUGAGAUA------------

----------------------------------------------------------------------------------AUA--CCCAUUGA---AC

CUGAAUCUGGACAAU-------------------------------GCCAGCG-CAGG--GA-GCAAUGCUUUUAUUUGGGG-3'

RS003701 (Lactobacillus plantarum WCFS1)

5'-UUUAAACACUAGGGGUGUCCAAAA-------------------------------------------------------------------------

--------------------------------------------------------------------------AUGG-GCUGAGAUGGUGCUGUA----

----------------------------------------------------------------------------AGUACCGAU--CCCUUUGA---AC

CUG--U-AAGCUCAA-------------------------------ACUUGCG-UAGG--AA---AGUGUCACAGCUAAUGU-3'

RS003702 (Lactobacillus casei)

5'-ACCUUCACAAAGGGGAGCCA-----------------------------------------------------------------------------

---------------------------------------------------------------------------UUG-GCUGAGAACGGGG--------

---------------------------------------------------------------------------AAACCCGGA--CCCUUCGA----AC

CUGU-UC--GUUAAU-------------------------------GCGAGCG-UAGG--GA--UUUGUGAAUGGU-------3'

RS003703 (Lactococcus lactis subsp. lactis Il1403)

5'-UAUUUGCACAAUGGGUCUAUUGACAAAACUG------------------------------------------------------------------

-------------------------------------------------------------------------UCAGU-AGCGAGAA-------------

----------------------------------------------------------------------------------AUA--CCAUCUG----AC

CUGA-UCUGGGUAAU-------------------------------GCCAGCG-UAGG--AA---UGUGUUAAGACAAAUGU-3'

RS003704 (Streptococcus pneumoniae R6)

5'-AACAACCACUAGGGGUGCGU-----------------------------------------------------------------------------

---------------------------------------------------------------------------AAA-GCUGAGAUUAACGA-------

----------------------------------------------------------------------------CUGUUAGAU--CCCUCUG----AC

UCAA-UCUAGGUAAU-------------------------------GCUAGCU-GAUG--GA---AGUGGAAAUGAUAAUGG-3'

RS003705 (Streptococcus criceti)

5'-AGGCGUCACAAGAGGAGCUU-----------------------------------------------------------------------------

----------------------------------------------------------------------------UU-GCUGAGAAUGACCUCCAGUUU

UAAGUAAAUUCCAUAACAUUGGAGUUUUGCGCAAAGUCUGG-----------------------------------GUGUCUAAA--CUCUUUGA---AC

CUGA-ACAAGGUAAU-------------------------------GCUUGCGUAAGG--GA---UGUGCAGAAAUAAGUGG-3'

RS003706 (Streptococcus pneumoniae R6)

5'-UACAGUCUGAGAGGAAGUGU-----------------------------------------------------------------------------

---------------------------------------------------------------------------UAA-ACU----UC------------

-----------------------------------------------------------------------------------GA--CCGC-------AC

CUGA-UCUGGGUAAU-------------------------------GCCAGCG-GAGG--GA--ACGAUACUUAGUCUAAUU-3'

RS003707 (Streptococcus agalactiae 2603V/R)

5'-AAAUACACAAGGGAGUGCCU-----------------------------------------------------------------------------

---------------------------------------------------------------------------UGA-GCUGAGAUUGCAGA-------

----------------------------------------------------------------------------UAUGCAAAA--UCCUCUA----AC

CUGA-UCUCGUUAGG-------------------------------ACGAGCG-UAGG--AA---UUGUGGUUUGAAUUGGU-3'

RS003708 (Streptococcus pneumoniae R6)

5'-UAAAGACAUUUGGGGUGCUU-----------------------------------------------------------------------------

---------------------------------------------------------------------------UAG-GCUGAGAU-------------

---------------------------------------------------------------------------------GAUA--CCCAUUGA---AC

CUGA-UACAGUUAAG-------------------------------ACUGGCG-AAGG--GA---AAUGUGAAAUGUUUUUU-3'

RS003709 (Streptococcus agalactiae NEM316)

5'-AUAGGACAUUUGGGGUGCGUA----------------------------------------------------------------------------

---------------------------------------------------------------------------ACA-GCUGAGAUU------------

----------------------------------------------------------------------------------AUA--CCCAUUGA---AC

UUGA-UACAGUUAGU-------------------------------ACUGUCG-AAGG--GA---AAUGUGUGCCAUUACAA-3'

RS003710 (Streptococcus mutans UA159)

5'-AAAUAUCACAAGGAGUGCUAAC---------------------------------------------------------------------------

--------------------------------------------------------------------------CUUA-GCUGAGAUUGCAU--------

-----------------------------------------------------------------------------UUGCAAAA--UCCUAUGG---AC

CUGA-UCUAGUUAAU-------------------------------ACUAGCG-UGGG--AA---UGUGAUUCGUUUCAUGA-3'

RS003711 (Streptococcus pneumoniae TIGR4)

5'-UAGAGACAUUUGGGGUGCUU-----------------------------------------------------------------------------

---------------------------------------------------------------------------UAG-GCUGAGAUA------------

----------------------------------------------------------------------------------AUA--CCCAUUGA---AC

CUGA-UACAGUUAAG-------------------------------ACUGGCG-AAGG--GA---AAUGUGAACAGUUUUUU-3'

RS003712 (Streptococcus pneumoniae R6)

5'-UAGAGACAUUUGGGGUGCUU-----------------------------------------------------------------------------

---------------------------------------------------------------------------UAA-GCUGAGAU-------------

---------------------------------------------------------------------------------GAUA--CCCAUUGA---AC

CUGA-UACAGUUAAG-------------------------------ACUGGCG-AAGG--GA---AAUGUGAAACGUUUUUU-3'

RS003713 (Streptococcus agalactiae 2603V/R)

5'-AUAGGACAUUUGGGGUGCGUA----------------------------------------------------------------------------

---------------------------------------------------------------------------ACA-GCUGAGAUU------------

----------------------------------------------------------------------------------AUA--CCCAUUGA---AC

UUGA-UGCAGUUAGU-------------------------------ACUGUCG-AAGG--GA---AAUGUGUGCCAUUACAA-3'

RS003714 (Streptococcus pyogenes MGAS8232)

5'-UAUUUCACAAAGGAGUGCUU-----------------------------------------------------------------------------

----------------------------------------------------------------------------UG-GCUGAGAUCGCAA--------

-----------------------------------------------------------------------------UUGCGAAA--UCCUGAGG---AC

CUGA-UCUUGUUAGU-------------------------------ACAAGCG-UAGG--GA---UUGUGACCAAUAAUCAA-3'

RS003715 (Streptococcus pneumoniae TIGR4)

5'-CAUAUAAUAUAUGGGAGUCUGUGU-------------------------------------------------------------------------

--------------------------------------------------------------------------ACAG-UCUGAGAGGAAGUGUU-----

----------------------------------------------------------------------------AAACUUCGA--CCGC-------AC

CUGA-UCUGGGUAAU-------------------------------GCCAGCG-GAGG--GAACGAUACUUAGUCUAAUUUU-3'

RS003716 (Mycoplasma gallisepticum R)

5'-AAUCAAUAACAGAGGUACCUCUUUUAUCUUGGAUAA-------------------------------------------------------------

-------------------------------------------------------------------------AAGAA-GUUGAGAA-------------

----------------------------------------------------------------------------------ACA--CUCUUAUG---AG

CUGA-UCUGGUUAAC-------------------------------ACCAGCG-UAGC--GA---GUUAUAUCUCUCACAAG-3'

RS003717 (Mycoplasma mycoides subsp. mycoides SC str. PG1)

5'-UAAAGUAAAUAAGGGUGCUGUA---------------------------------------------------------------------------

--------------------------------------------------------------------------AAAG-GCUGAGAUU------------

----------------------------------------------------------------------------------AUA--CCUAUU-----AG

CAGA-UCAUGGUAAU-------------------------------UCAUGCG-UGGCUAAA--GAUUUUUUACAGGUUAUG-3'

RS003718 (Mycoplasma hyorhinis)

5'-UUAUUUCAACAGGGGAGCUGUA---------------------------------------------------------------------------

--------------------------------------------------------------------------AAAG-GCUGAGAA-------------

----------------------------------------------------------------------------------AUA--CUCUAUA----AG

UUGA-UCUAGAUAAU-------------------------------GCUAGCG-UAAC--GA---GUUGUUUUUUAUUUUCA-3'

RS003719 (Mycoplasma pulmonis)

5'-AAACAUAGACAGGGGUACUUAUCUAUCAAAAAUAG--------------------------------------------------------------

-------------------------------------------------------------------------AUAUG-GUUGAGAUC------------

----------------------------------------------------------------------------------AAA--CUCUUG-----AG

CUGA-UCUAAUUAAU-------------------------------AUUAGCG-UAGC--GA---GUCUUUGGUAAAAUAAU-3'

RS003720 (Mycoplasma pulmonis)

5'-UAACAAAGGCAGGGGUACUAUAUCUCACUGAAAAAGUAG----------------------------------------------------------

-------------------------------------------------------------------------GUAUG-GUUGAGAA-------------

----------------------------------------------------------------------------------AAA--CUCUUU-----AG

CUGA-UCUAAUUAAU-------------------------------AUUAGCG-UAGC--GA---GACUUUAAAUUUCGUCU-3'

RS003721 (Caulobacter crescentus CB15)

5'-GUCUGUUCACCGGGGGGCCGCUCG-------------------------------------------------------------------------

--------------------------------------------------------------------------CGCG-GCUGAGAUUGGGCUC------

---------------------------------------------------------------------------ACGCCCUGA---CCCGUAGA---AC

CUGA-UCCGGGUCAU-------------------------------GCCGGCG-AAGG--GA---GGGAACGCGGACGACAG-3'

RS003722 (Rhodopseudomonas palustris CGA009)

5'-GCCCGUUCCGAGGGGGGCUCCGAC-------------------------------------------------------------------------

-------------------------------------------------------------------------GAGGA-GCUGAGAUACCGCACGCUCGC

CGCUUCGCUCCGCGAGGCACAGAGA--------------------------------------------------CCGCGGUGA---CCCUUUGA---AC

CUGA-UCCGGGUCAU-------------------------------GCCGGCG-AAGG--GA--CAGGGAUGCAUCAGACAG-3'

RS003723 (Brucella melitensis 16M)

5'-GUCGCUCUAACGGGGUGCCAUCUGCUUUUGG------------------------------------------------------------------

-------------------------------------------------------------------------GGAUG-GCUGAGAGGCCAAACAAGGCA

UUUCCAGCAAAAGCGUGAAACGGUUUUGCAUCAGGAAAUACUUGAAAACUG-------------------------CCCGGCCAA--CCCGCUGA---AC

CUGA-UCCGGUUUGC-------------------------------ACCGGCG-GAGG--GA---UUAGACGCUCGAUGAAC-3'

RS003724 (Brucella melitensis 16M)

5'-CAAAAUUCGUUGGGGUGCCUUGAA-------------------------------------------------------------------------

--------------------------------------------------------------------------AGAG-GCUGAGAGACGCAUUC-----

----------------------------------------------------------------------------UCACGUCAA--CCCAUUGA---AC

CUGA-UCCGGGUAAU-------------------------------ACCUGCG-UAGG--GA---ACGGAGUUUGGCGCGUC-3'

RS003725 (Mesorhizobium loti)

5'-CGCAUUCACCAGGGGAGUCCCGGC-------------------------------------------------------------------------

-------------------------------------------------------------------------AAGGG-GCUGAGAUACUGCUGGCUUUC

GCG------------------------------------------------------------------------GCGCAGUGA---CCCGUUGA---AC

CUGA-UCCAGUUCAU-------------------------------ACUGGCG-UAGG--GA--CGGUGCAAGCGCUUUGCG-3'

RS003726 (Agrobacterium tumefaciens str. C58)

5'-AGCUCUUCCGAGGGGAGCACCAGA-------------------------------------------------------------------------

--------------------------------------------------------------------------CGGU-GCUGAGAUGGUGG--------

----------------------------------------------------------------------------UGAACCGGA--CCCUUGA----AC

CUGA-UCCGGGUCAU-------------------------------GCCGGCG-UAGG--AA---CGGAACUGUCGUGCGCU-3'

RS003727 (Agrobacterium tumefaciens str. C58)

5'-CUUGAUCUAACGGGGUGUCUUCUGUGCUUUUGUGC--------------------------------------------------------------

-------------------------------------------------------------------------AGAAG-GCUGAGAGGCU----------

-------------------------------------------------------------------------------UGCCAA--CCCGAAGA---AC

CUGA-UCCGGUUCAU-------------------------------ACCGGCG-GAGG--GA---UUAGACGGCUUAAAGGC-3'

RS003728 (Agrobacterium tumefaciens str. C58)

5'-GCCAUUCACCAGGGGUGUCCCGUC-------------------------------------------------------------------------

-------------------------------------------------------------------------AAGGG-GCUGAGAUUCUGCUUUCAU--

-----------------------------------------------------------------------------GCGCAGUGA-CCCGUUGA---AC

CUGA-UCCAGUUCAU-------------------------------ACUGGCG-UAGG--GA--CGGUGCAAAGACCUGAUG-3'

RS003729 (Rhizobium etli)

5'-ACCAUUCACCAGGGGUGCCCCGGC-------------------------------------------------------------------------

-------------------------------------------------------------------------AAGGG-GCUGAGAUUCUGCUGAACAAU

ACGGCUUUGCCUGUUGUG----------------------------------------------------------GCGCGGUGA--CCCGUUGA---AC

CUGA-UCCAGUUCAU-------------------------------ACUGGCG-UAGG--GA--CGGUGCGGACCUGCGGCU-3'

RS003730 (Rhizobium sp. NGR234)

5'-CUCCAUUCCGAGGGGAGCGCCGGG-------------------------------------------------------------------------

--------------------------------------------------------------------------CGGC-GCUGAGACGGCGG--------

----------------------------------------------------------------------------UGAGCCGGA--CCCUUGA----AC

CUGA-UCCGGGUCAU-------------------------------GCCGGCG-UAGG--AA---CGGAACGAGGCUGCCCU-3'

RS003731 (Sinorhizobium meliloti)

5'-GCGCAUUCCGAGGGGAGCACUAGA-------------------------------------------------------------------------

--------------------------------------------------------------------------CGGU-GCUGAGAUGGCGU--------

----------------------------------------------------------------------------UGAGCCGGA--CCCUUGA----AC

CUGA-UCCGGGUCAU-------------------------------GCCGGCG-UAGG--AA---CGGAAAGAAGGCCGCCA-3'

RS003732 (Sinorhizobium meliloti)

5'-GCUGCUCUAACGGGGUGCCCUGGCCGGCUUUGCGA--------------------------------------------------------------

-------------------------------------------------------------------------CCAUG-GCUGAGAGGCUUC--------

------------------------------------------------------------------------------GAGCCAA--CCCGCGGA---AC

CUGA-UCCGGCUCAU-------------------------------ACCGGCG-GAGG--GA---UUAGAAGCGAUCGGACC-3'

RS003733 (Wolbachia endosymbiont of Drosophila melanogaster)

5'-UACACGCAUUAGGGGUGCUCUAG--------------------------------------------------------------------------

--------------------------------------------------------------------------AAAA-GCUGAGAGUACAU--------

----------------------------------------------------------------------------AAAGUACAA--CCCUUUGA---AC

CUGA-UAUUGUUAAA-------------------------------GCAAGCG-UAGG--GA---AAUAUAUGUAUAUAAAU-3'

RS003734 (Bordetella parapertussis)

5'-AGGAUCACGCAGGGGUACUCGCUGUCCCGCCUUCAAGGCCGGC------------------------------------------------------

-------------------------------------------------------------------------AGCGU-GUUGAGAG-------------

----------------------------------------------------------------------------------AGU--CCCUUCGU---AC

CAG--UACGGAUAAU-------------------------------GCCGAUG-CUGG--GA---GCGUAUUCCAGUUGCCG-3'

RS003735 (Ralstonia solanacearum)

5'-UGGAUGAAACAGGGGUGCCGUGCGGAUGGGCC-----------------------------------------------------------------

-------------------------------------------------------------------------GCGCG-GCUGAGAG-------------

----------------------------------------------------------------------------------AGU--CCCUUCGC---AC

CCGA-UCCGGUUCGU-------------------------------ACCGGCG-UGGG--AA---GUUUCUUCAGAACACCG-3'

RS003736 (Chromobacterium violaceum ATCC 12472)

5'-CCCUGUCACCGGGGGUGCCCGCCA-------------------------------------------------------------------------

-------------------------------------------------------------------------UGCGG-GCUGAGAG-------------

----------------------------------------------------------------------------------ACA--CCCUGAGA---AC

CUGA-UCUGGAUCAU-------------------------------GCCAGCG-GAGG--GA--GCGUGAUGAAGCGGAAUC-3'

RS003737 (Chromobacterium violaceum ATCC 12472)

5'-CGGCAUCGCUAGGGGUCCUGCGCCUGGCGUUCGGCGCAGAUGGCUAGCAAAGUGUAGGCCAUGGCGGCGGAUGACGGA-------------------

-------------------------------------------------------------------------GCGCG-GGUGAGAA-------------

----------------------------------------------------------------------------------AUA--CCCUUGGA---AC

CUGA-CCCGGAUAAU-------------------------------ACCGGCG-UAGG--GA---AGCGUCACCUGCCCGCC-3'

RS003738 (Neisseria meningitidis Z2491)

5'-GCUUUCUUGUCGGAGUGCCGCCGCC------------------------------------------------------------------------

-------------------------------------------------------------------------GGGCG-GCUGAGAUUGCGA--------

-----------------------------------------------------------------------------AAGCAGAA--UCCGUAGA---AC

CUG--UCGGGGUAAU-------------------------------GCCUGCG-UAGG--AA---ACAAACCGUCAAAUGCC-3'

RS003739 (Neisseria meningitidis Z2491)

5'-ACAUCGAAACAGGGGUGCUGCCUGAUGUUC-------------------------------------------------------------------

-------------------------------------------------------------------------AGGCG-GCUGAGAA-------------

----------------------------------------------------------------------------------AUA--CCCUUUAC---AC

CCGA-UCGGGAUAAU-------------------------------ACCUGCG-UGGG--GA---GUUUUCACGGAUUCUGC-3'

RS003740 (Nitrosomonas europaea ATCC 19718)

5'-AGCUGUGGCUAGGGGUCCGCAUUUGCAGUUUUCUGCAA-----------------------------------------------------------

-------------------------------------------------------------------------AUGCC-GGUGAGAG-------------

----------------------------------------------------------------------------------AGU--CCCUUAAU---AC

CUGA-UGCGGAUAAC-------------------------------GCCGCCG-GAGG--GA---AGCCAGGAGUCACUCUC-3'

RS003741 (Bdellovibrio bacteriovorus)

5'-ACCUGACGCUAGGGGUGUUGGUGAAUU----------------------------------------------------------------------

-------------------------------------------------------------------------CACCG-ACUGAGAA-------------

----------------------------------------------------------------------------------UAA--CCCUUUGA---AC

CUGA-UAGAGAUAAU-------------------------------GCUCGCG-CAGG--GA---AGCAAGAAUAGAAAGAU-3'

RS003742 (Campylobacter jejuni subsp. jejuni NCTC 11168)

5'-AACAUAAAUGACGGGAGCUUGUGU-------------------------------------------------------------------------

-------------------------------------------------------------------------AACAG-GCUGAGAGUAAGCUAA-----

---------------------------------------------------------------------------AAGCUUA-GA--CCGA-------AC

CGGA-UCUGGAUAAU-------------------------------ACCAGCG-UCGG--GA--AGAUUUAUAAAUUUCAAU-3'

RS003743 (Helicobacter pylori J99)

5'-GGAGCAUUUAAGGGGUGCUUUUUAAAACGCUCAAGUUUUU---------------------------------------------------------

-------------------------------------------------------------------------AAAAG-GCUGAGAUC------------

----------------------------------------------------------------------------------AAA--CCCGUAGA---AC

UUG--UCAAGGUAAU-------------------------------UCUUGCG-UAAG--GA--AUAACAUGUUAAUAACCA-3'

RS003744 (Helicobacter pylori 26695)

5'-AGCAUUUA--AGGGGUGCUUUUUAAAACGCUCAAGUUUUU---------------------------------------------------------

-------------------------------------------------------------------------AAAAG-GCUGAGAUC------------

----------------------------------------------------------------------------------AAA--CCCGUAGA---AC

UUG--UCAAGGUAAU-------------------------------UCUUGCG-UAAG--GA--A-AUAGCAUGUUAAUAAC-3'

RS003745 (Aeromonas hydrophila)

5'-GCCAUCUUGUCGGAGUGCCAACCGUCGAACGAC----------------------------------------------------------------

-------------------------------------------------------------------------GCGAG-GCUGAGACCGUUA--------

-----------------------------------------------------------------------------AUUCGGGA--UCCGUGGA---AC

CUGA-UCAGGCUAGC-------------------------------ACCUGCG-AAGG--GA--AACAAGGGUAACUUGCGG-3'

RS003746 (Shewanella oneidensis MR-1)

5'-UGUUUGCCAAA----AUUCGG----------------------------------------------------------------------------

---------------------------------------------------------------------------CAG-ACUGAGAUGUCAU--------

-----------------------------------------------------------------------------CAGACGAA--CCCUUAGA---AC

CUGA-UCCGGCUAAU-------------------------------ACCGGCG-UAGG--AA---UGGGCCAAUCAACAGCA-3'

RS003747 (Shewanella oneidensis MR-1)

5'-UGCCUUUUGGCUGAGACCGUUU---------------------------------------------------------------------------

--------------------------------------------------------------------------AUUC-GG-------------------

-----------------------------------------------------------------------------------GA--UCCGUUGA---AC

CUGA-UCAGGUUAAA-------------------------------ACCUGCG-AAGG--AA---ACAAGCAUAAUAACUUC-3'

RS003748 (Thiocystis violacea)

5'-CCAUACUGCUGGGGGUGUCCGUGACGACCCGCUCGGCUUGGAUUUUCGGCGCUGGGCGCUCAGACGUCCAGCCGCUAUCCCUGCCGAGAGUUUCGCG

U------------------------------------------------------------------------CUCGG-GCUGAGAAA------------

----------------------------------------------------------------------------------AGA--CCCUUCGA---AC

CUGA-UCCGGAUCAU-------------------------------GCUGGCG-CAGG--AA---AGCAGGCAAGACAGAGG-3'

RS003749 (Erwinia pyrifoliae)

5'-AGUCCCUGUCAGGGGAGUCUCGCCA------------------------------------------------------------------------

-------------------------------------------------------------------------GAGAG-ACUGAGAGGCUAAUAGCGAUU

UUCGCG---------------------------------------------------------------------GCUUAGC-GA--CCCUUAGA---AC

CUGA-CCCAGCUGAU-------------------------------ACUGGCG-UAGG--AA---GACUCGUAUCUUGAUGA-3'

RS003750 (Erwinia amylovora)

5'-GGUUCCUGUCAGGGGAGUCUCGCCA------------------------------------------------------------------------

-------------------------------------------------------------------------GAGAG-ACUGAGAGGCUGAUAGCGAUU

UUCGCG---------------------------------------------------------------------GCUUAGC-GA--CCCUUAGA---AC

CUGA-CCCAGCUGAU-------------------------------ACUGGCG-UAGG--AA---GACUCGUAUCUUGAUAA-3'

RS003751 (Escherichia coli CFT073)

5'-CCGUUCUCAACGGGGUGCCACGCAGCC----------------------------------------------------------------------

-------------------------------------------------------------------------GCGUGCGCUGAGAAA------------

----------------------------------------------------------------------------------AUA--CCCGUCGA---AC

CUGA-UCCGGAUAAC-------------------------------GCCGGCG-AAGG--GA--UUUGAGGCUCCUUCUCAA-3'

RS003752 (Escherichia coli W3110)

5'-CCGUUCUCAACGGGGUGCCACGCGUAC----------------------------------------------------------------------

-------------------------------------------------------------------------GCGUGCGCUGAGAAA------------

----------------------------------------------------------------------------------AUA--CCCGUCGA---AC

CUGA-UCCGGAUAAC-------------------------------GCCGGCG-AAGG--GA--UUUGAGGCUCCUUCUCAA-3'

RS003753 (Escherichia coli CFT073)

5'-CCAAACGACUCGGGGUGCCCUUCUUUG----------------------------------------------------------------------

-------------------------------------------------------------------------UGAAG-GCUGAGAA-------------

----------------------------------------------------------------------------------AUA--CCCGUAUC---AC

CUGA-UCUGGAUAAU-------------------------------GCCAGCG-UAGG--GA---AGUCACGGACCACCAGG-3'

RS003754 (Photorhabdus luminescens subsp. laumondii TTO1)

5'-ACUUUCUUGUCGGAGUGCCUAGCGUAAGCUGUUUUAUCGCAGCAUA---------------------------------------------------

-------------------------------------------------------------------------CACAG-GCUGAGACCGUUA--------

-----------------------------------------------------------------------------AUUCGGGA--UCCGCGGA---AC

CUGA-UCGGGUUAAU-------------------------------ACCCGCG-AAGG--GA---ACAAGAGUAAUCAACCG-3'

RS003755 (Photorhabdus luminescens subsp. laumondii TTO1)

5'-GCCAUCUCAACGGGGUGCUGGCUGUUUAAAACA----------------------------------------------------------------

-------------------------------------------------------------------------GCCUU-GCUGAGAGU------------

----------------------------------------------------------------------------------AAA--CCCGCCGA---AC

CUGA-UCCGGCUAAU-------------------------------ACCGGCG-UAGG--GA--UUUGAGCUGCUAACUAUU-3'

RS003756 (Salmonella enterica subsp. enterica serovar Typhi)

5'-GUUAUCUUGUCGGAGUGCUAAUUUUCCACAAAAGCGUUCGUGAUGCGUCAAGGCGGCAAGUCGGUGAAUCUCCAGGAGCUUACAUAAGUAAGUGACU

GGAGUGAGCGGACGAAGCCAACGAAGAGGCAGCGCGAAGGAUGAAGUGG------------------------AAAAG-GCUGAGACCGUUA--------

-----------------------------------------------------------------------------AUUCGGGA--UCCGCGGA---AC

CUGA-UCAGGUUAAU-------------------------------ACCUGCG-AAGG--GA---ACAAGAGUAAUUCUGCU-3'

RS003757 (Salmonella enterica subsp. enterica serovar Typhi)

5'-CCGAACUCAACGGGGUGCCGCGCUCAU----------------------------------------------------------------------

-------------------------------------------------------------------------GCGCGCGCUGAGAAA------------

----------------------------------------------------------------------------------AUA--CCCGUCGA---AC

CUGA-UCCGGAUAAU-------------------------------GCCGGCG-AAGG--GA--UUUGAGGCUACCUCUCAA-3'

RS003758 (Salmonella enterica subsp. enterica serovar Typhi Ty2)

5'-CUUGACGACUCGGGGUGCCCUUCUUUG----------------------------------------------------------------------

-------------------------------------------------------------------------UGAAG-GCUGAGAA-------------

----------------------------------------------------------------------------------AUA--CCCGUACC---AC

CUGA-UCUGGAUAAU-------------------------------GCCAGCG-UAGG--GA---AGUCUGACACUGCUCGU-3'

RS003759 (Shigella flexneri 2a str. 2457T)

5'-CCAAACGACUCGGGGUGCCCUUCUGCG----------------------------------------------------------------------

-------------------------------------------------------------------------UGAAG-GCUGAGAA-------------

----------------------------------------------------------------------------------AUA--CCCGUAUC---AC

CUGA-UCUGGAUAAU-------------------------------GCCAGCG-UAGG--GA---AGUCACGGACCACCAGG-3'

RS003760 (Shigella flexneri 2a str. 2457T)

5'-CCGUUCUCAACGGGGUGCCACGCAAAC----------------------------------------------------------------------

-------------------------------------------------------------------------GCGUGCGCUGAGAAA------------

----------------------------------------------------------------------------------AUA--CCCGUCGA---AC

CUGA-UCCGGAUAAC-------------------------------GCCGGCG-AAGG--GA--UUUGAGGCUCCUUCUCAA-3'

RS003761 (Yersinia pestis CO92)

5'-AGGCUCUUGUCGGAGUGCCUAGCACCUGCUUUUUUAGGAAAGCAAA---------------------------------------------------

-------------------------------------------------------------------------CGCAG-GCUGAGACCGUUA--------

-----------------------------------------------------------------------------AUUCGGGA--UCCGCGGA---AC

CUGA-UCGGGUUAAU-------------------------------ACCCGCG-AAGG--GA---ACAAGAGUAAUUUAUCG-3'

RS003762 (Yersinia pestis CO92)

5'-CAUUCUGACUCGGGGUGCCUGCCACAAUGCGGUG---------------------------------------------------------------

-------------------------------------------------------------------------GUAAG-GCUGAGAGA------------

----------------------------------------------------------------------------------UGA--CCCGUAUU---AC

CUGA-UCUGGAUUAU-------------------------------GCCAGCG-UAGG--GA---AGUCUCGGCACCGUAGG-3'

RS003763 (Yersinia pestis KIM)

5'-ACCACCUAACCGC--CGCAAUUUU-------------------------------------------------------------------------

--------------------------------------------------------------------------UUUC-GCUGAGAGU------------

----------------------------------------------------------------------------------AAA--CCCGUCGA---AC

CUGA-UCCGGUUAAC-------------------------------CCCGGCG-GAGG--GA---UUUGAGAAUGAUAACGA-3'

RS003764 (Haemophilus influenzae Rd KW20)

5'-GACUUUUAGUCGGGGUGCCGA----------------------------------------------------------------------------

---------------------------------------------------------------------------AAG-GCUGAGAU-------------

---------------------------------------------------------------------------------GAUA--CCCGUGA----AC

CUGA-AACAGUUAGC-------------------------------ACUGACG-UAGG--AA---ACUAAUAUGCCACAUAU-3'

RS003765 (Haemophilus influenzae Rd KW20)

5'-AGUUUUUAGUCGGGGUGCCGA----------------------------------------------------------------------------

---------------------------------------------------------------------------AAG-GCUGAGAU-------------

---------------------------------------------------------------------------------GAUA--CCCGUGA----AC

CUGA-AACAGUUAGC-------------------------------ACUGACG-UAGG--AA---ACUAAUAUGCCAAAAAA-3'

RS003766 (Haemophilus ducreyi 35000HP)

5'-UUGUUCUCAUUGGGGUGCUGAAA--------------------------------------------------------------------------

--------------------------------------------------------------------------AUAA-GCUGAGAA-------------

----------------------------------------------------------------------------------AUA--CCCAUAGA---AC

CUGA-UCUGAUUCGU-------------------------------AUCAGCG-UAGG--GA--UUUGAGGCCAUUUCUACU-3'

RS003767 (Haemophilus influenzae Rd KW20)

5'-AAAGCCUAGUCGGGGUGCAA-----------------------------------------------------------------------------

---------------------------------------------------------------------------UAC-GCUGAGAUC------------

----------------------------------------------------------------------------------AUA--CCCGUGA----AC

CUGA-AACAGUUAAU-------------------------------ACUGACG-UAGG--AA---ACUAGGAAUAUAACCUU-3'

RS003768 (Histophilus somni)

5'-CCGACUUAGUCGGGGUGCUGAU---------------------------------------------------------------------------

--------------------------------------------------------------------------AACA-GCUGAGAUA------------

----------------------------------------------------------------------------------AUA--CCCGUGA----AC

CUGA-UACAGUUAAU-------------------------------ACUGACG-UAGG--AA---ACUAAUGGUCUUACUCC-3'

RS003769 (Pasteurella multocida subsp. multocida str. Pm70)

5'-GACUCUUAGUCGGGGUGCUAUUGC-------------------------------------------------------------------------

--------------------------------------------------------------------------GUUA-GCUGAGAU-------------

---------------------------------------------------------------------------------GAUA--CCCGUGA----AC

CUGA-UGCAGUUAAU-------------------------------ACUGACG-UAGG--AA---ACUAGCAGUCAAUAUUG-3'

RS003770 (Pasteurella multocida subsp. multocida str. Pm70)

5'-GCACUUUAGUCGGGGUGCUUUGUAACCAAAUUGU---------------------------------------------------------------

-------------------------------------------------------------------------ACAAA-GCUGAGAU-------------

---------------------------------------------------------------------------------GAUA--CCCGUGA----AC

CUGA-UACAGCUAAC-------------------------------ACUGACG-UAGG--AA---ACUAAUUAUGCCAAUAA-3'

RS003771 (Pseudomonas putida KT2440)

5'-AGCGCCACCAAGGGGAGCCCGGCA-------------------------------------------------------------------------

--------------------------------------------------------------------------AUGG-GCUGAGAAACCGCUGAACGCU

ACA------------------------------------------------------------------------GCGCGGU-GA--CCCUUCGA---AC

CUGA-UCCGGAUCAU-------------------------------GCCGGCG-AAGG--GA---UGGGGCUUGUAACCUGC-3'

RS003772 (Pseudomonas putida KT2440)

5'-AUGUUCUUGUCGGGGUGCCUUGAAG------------------------------------------------------------------------

-------------------------------------------------------------------------CAAAG-GCUGAGAUCGCAGA-------

----------------------------------------------------------------------------GGUGCGGAU--CCCGUUGA---AC

CUGA-UCAGGUUAGC-------------------------------GCCUGCG-UAGG--GA---ACAAGAUUGCUCGCCUU-3'

RS003773 (Pseudomonas aeruginosa PAO1)

5'-GGGUUCUUGUCGGGGUGCCCUAUAC------------------------------------------------------------------------

-------------------------------------------------------------------------GAGGG-GCUGAGAUCGGAUA-------

----------------------------------------------------------------------------GUUCCGGAU--CCCGUUGA---AC

CUGA-UCGGGCUAGC-GUCCGGUUCCGCCUCGCGCGGACCGCAGCAACCCGCG-UAGG--GA---ACAAGAUGUCCGCGCCA-3'

RS003774 (Vibrio cholerae O1 biovar eltor str. N16961)

5'-GUCCUGUAGUCGGGGAGCCUGAGAGCGUAUAUACCCUUCUUACUUGAAGCUGCAGCGGUGUUGGCUACGUUCGUUCACCCCAAUCACAUAGUUUAUC

UAUGCUCAUGGGGAUGAACUCACUUGUCGCCUACCUGCAACUCCAAGUAGUUUGGGUAUAACAACGUGCGAAUUAAAG-GCUGAGAUCGCG---------

-----------------------------------------------------------------------------UAGCGAGA--CCCGUUGA---AC

CUGA-UUCAGUUAGG-------------------------------ACUGACG-UAGG--GA---ACUAUCCUCAACCGCUG-3'

RS003775 (Vibrio cholerae O1 biovar eltor str. N16961)

5'-UUCCACUUGUCGGAGUGCCAU----------------------------------------------------------------------------

---------------------------------------------------------------------------UGG-GCUGAGACCGUUU--------

-----------------------------------------------------------------------------AUUCGGGA--UCCGUUGA---AC

CUGA-UCAGGUUAAU-------------------------------ACCUGCG-AAGG--GA---ACAAGAGAAGACUCUCU-3'

RS003776 (Vibrio vulnificus CMCP6)

5'-UUUCACUUGUCGGAGUGCCUU----------------------------------------------------------------------------

---------------------------------------------------------------------------AGG-GCUGAGACCGUUU--------

-----------------------------------------------------------------------------AUUCGGGA--UCCGUUGA---AC

CUGA-UCAGGUUAGA-------------------------------ACCUGCG-AAGG--GA---ACAAGAGAAGAUACUUG-3'

RS003777 (Xanthomonas campestris pv. campestris str. ATCC 33913)

5'-CCGCCGAAGUGGGGGUACCACAGCACUG---------------------------------------------------------------------

-------------------------------------------------------------------------CUGCG-GUUGAGAU-------------

----------------------------------------------------------------------------------AGU--CCCUUCGA---AC

CUGA-UCCGGCUCAU-------------------------------ACCGGCG-UAGG--GA--AGCUUCGUUAGAUGCGCU-3'

RS003778 (Xanthomonas axonopodis pv. citri str. 306)

5'-CCGCCGAAGUGGGGGUACCGCAGCGUG----------------------------------------------------------------------

-------------------------------------------------------------------------CUGCG-GUUGAGAU-------------

----------------------------------------------------------------------------------AGU--CCCUUCGA---AC

CUGA-UCCGGCUGAU-------------------------------ACCGGCG-UAGG--GA--AGCUUCGUCAGAUGCGAU-3'

RS003779 (Xylella fastidiosa 9a5c)

5'-GCUUUGAAGCGGGGGUACCAUAGCCAAG---------------------------------------------------------------------

-------------------------------------------------------------------------CUGCG-GUUGAGAC-------------

----------------------------------------------------------------------------------ACA--CCCUUCGA---AC

CUGA-UCCGGUUUAC-------------------------------ACCGGCG-UAGG--AA--AGCUUCGUGGACCGCGCC-3'

RS003780 (Xylella fastidiosa Temecula1)

5'-ACUUUGAAGCGGGGGUACCGUAGCCAAG---------------------------------------------------------------------

-------------------------------------------------------------------------CUGCG-GUUGAGAC-------------

----------------------------------------------------------------------------------ACA--CCCUUCGA---AC

CUGA-UCCGGUUUAC-------------------------------ACCGGCG-UAGG--AA--AGCUUCGUGGACCGCGCC-3'

RS003781 (Leptospira interrogans serovar Lai str. 56601)

5'-CUUGGACGUUGGGGGUGGGAUUCACUGCGU-------------------------------------------------------------------

-------------------------------------------------------------------------GAAUC-UCUGAGAG-------------

----------------------------------------------------------------------------------AGU--CCCC-GGA---AC

CUGA-UCAGGAUAAG-------------------------------ACCUGCG-UAGG--AA---AACGGACCUGUAAAAUU-3'

RS003782 (Thermotoga maritima MSB8)

5'-ACCUUCCCCAGGGGGAGCUCCUAUU------------------------------------------------------------------------

-------------------------------------------------------------------------CCGGG-GCUGAGAGGAGGACGGA----

----------------------------------------------------------------------------AGUCCUCGA--CCCCAAGA---AC

CUGA-UCCGGGUAAU-------------------------------GCCGGCG-GAGG--GA---UCGGGGAAGGAGGAAAU-3'

RS003783 (Emericella nidulans)

5'-UCUGGGCGUGGCCGGUGUUCGUUCUUAUCCUUAGCAUAUCCCUACCUCAACUGUACUGGCCUUUAUCCAGCGUUGAAGGGGACUGCCAAAGGCUCUG

GG-----------------------------------------------------------------------UUCGU-UCUGAGAAU------------

----------------------------------------------------------------------------------AUA--CGGUCAAA---AC

UUGA-UCUGGAUAAU-------------------------------ACCAGCG-AAAG--GA--UCAUGCCUUCCCUUGCCU-3'

RS003784 (Aspergillus oryzae)

5'-ACAUGGCAUCGAUGGACUGGGU---------------------------------------------------------------------------

--------------------------------------------------------------------------UCGU-UCUGAGAUU------------

----------------------------------------------------------------------------------AUA--CGGCUAAA---AC

UUGA-UCUGGAUAAU-------------------------------ACCAGCGAAAAG--GG--UCAUGCCUUCUCUCGUUC-3'

RS003785 (Aspergillus oryzae)

5'-UGGAGGGGUACCGGGUGUACGAGGCAGAGUCCG----------------------------------------------------------------

-------------------------------------------------------------------------GUCGU-UCUGAGAUU------------

----------------------------------------------------------------------------------AUA--CUGUCAUA---AC

UUGA-UCUAGAUAAU-------------------------------ACUAGCG-AAAG--GA---CAUGCGUGGCAUUGAUU-3'

RS003786 (Nectria haematococca)

5'-GUGUACAUCAA----UGUCAAGAAGAGGAGA------------------------------------------------------------------

-------------------------------------------------------------------------GCGUG-GCUGAGAUU------------

----------------------------------------------------------------------------------AUA--C-GGCGAA---AC

UUGA-UCUGGAUAAU-------------------------------ACCAGCG-AAAG--GA---UCAUGCUCUCCUCCCCC-3'

RS003787 (Fusarium oxysporum)

5'-UCAUGCAUGAGCCGGUGCCCAUUCUUCUCCCAUCAGCAUGGUCAGUUCAAACUGGUCGUGUUGAUGAUAGGGGG-----------------------

-------------------------------------------------------------------------AUGUG-GCUGAGAUU------------

----------------------------------------------------------------------------------AUA--CGGCAAA----AC

UUGA-UCUGGAUAAU-------------------------------ACCAGCG-AAAG--GA---UCAUGUCAUCUCCCCUA-3'

RS003788 (Neurospora crassa)

5'-AAGACAGCUACCGGGUGUCCAUGUUGGUACAGCCACAGUUGGUUCACCCUUAUCGCUCUUCCAUGCCUUCUGUGACAAGGUCUUUGGAAUGAGUUUG

AUACGAUGGGCCAACUGCGGCGGUACCAC--------------------------------------------GUUGG-UCUGAGAA-------------

----------------------------------------------------------------------------------AUA--CCGGCGA----AC

UUGA-UCUGGAUAAU-------------------------------ACCAGCG-AAAG--GA--UUGGCUUCUUGGGACCCC-3'

RS003789 (Oryza sativa)

5'-AAGUUGCACCAGGGGUGCCUGUAUUCUCAACGAUCUGAAGGCCUCUUGGCCUGGAUUGUUGUGA---------------------------------

-------------------------------------------------------------------------AUUGG-GCUGAGAA-------------

----------------------------------------------------------------------------------AGU--CCCUUUGA---AC

CUGA-ACAGGAUAAU-------------------------------GCCUGCG-AAGG--GA--GUGUGCAUUUCUACUUUU-3'

RS003790 (Oryza sativa (japonica cultivar-group))

5'-UGUUAGGAGGUGGGGUGCCUGUAUUCUCAACGAUCUGAAGGCCUCUUGGCCUGGAUUGUUGUGA---------------------------------

-------------------------------------------------------------------------AUUGG-GCUGAGAA-------------

----------------------------------------------------------------------------------AGU--CCCUUUGA---AC

CUGA-ACAGGAUAAU-------------------------------GCCUGCG-AAGG--GA--GUGUGCAUUUCUACUUUU-3'

RS003791 (Oryza sativa (japonica cultivar-group))

5'-UUGAAUGACUCGGGGUGCCCCUUUUCAC---------------------------------------------------------------------

-------------------------------------------------------------------------AAAGG-GCUGAGAA-------------

----------------------------------------------------------------------------------AUA--CCCGUACC---AC

CUGA-UCUGGAUAAU-------------------------------GCCAGCG-UAGG--GA---AGUCAGAUGCCUGCCCG-3'

RS003792 (Oryza sativa (japonica cultivar-group))

5'-CUAUGUUAGGAGGUGGCCUCUUGGCCUGGAUUGUUGUGA----------------------------------------------------------

-------------------------------------------------------------------------AUUGG-GCUGAGAA-------------

----------------------------------------------------------------------------------AGU--CCCUUUGA---AC

CUGA-ACAGGAUAAU-------------------------------GCCUGCG-AAGG--GA--GUGUGCAUUUCUACUUUU-3'

RS003793 (Poa secunda)

5'-AAGUUGCACCAGGGGUGCCUGUAUUCUCAACAAUCUGAAGGGCCCUUGGCCUGGAUUGUUGUGA---------------------------------

-------------------------------------------------------------------------UAUGG-GCUGAGAA-------------

----------------------------------------------------------------------------------AGU--CCCUUUGA---AC

CUGA-ACAGGAUAAU-------------------------------GCCUGCG-UAGG--GA--GUGUGCAUUUCUAUUUUG-3'

RS003794 (Arabidopsis thaliana (thale cress))

5'-CAAAAGCACCAGGGGUGCUUGAACCAGGAUAGCCUGCGAAAAGGCGGGCUAUCCGGG----------------------------------------

-------------------------------------------------------------------------ACCAG-GCUGAGAA-------------

----------------------------------------------------------------------------------AGU--CCCUUUGA---AC

CUGA-ACAGGGUAAU-------------------------------GCCUGCG-CAGG--GA--GUGUGCAGUUUUUUUUUU-3'


References:

  1. Griffiths-Jones, S., Bateman, A., Marshall, M., Khanna, A., Eddy, S.R., RFam: an RNA family database, Nucleic Acids Research, 2003, 31, 1, 439-441.