English
Français

Database

Multiple Alignment

IDsAligned Sequences
Consensus structure

5'-.....<<<...<<<........>>>..>>>....<<<<.......>>>>..........................................<<<.<<

.....<<<..<<<<<.......>>>>>..>>.>...>>.>>>.....<<<<.<<<<....>>>>>>>>....<<<<<<......................

.........>>>.>>>......<<<<<<<<..<<<<<<.......>>>>>>......>>>>>>>>........<<<<<<....>>>>>>-3'

 
RS011466 (Simian retrovirus 1)

5'-UGGCGCCCAACGUGGCGUUGGAUACGAGGGAAUUUCGUGAGGAAGACGACGCGGUUUGCCGGCCCG--GAUUAAAAGAGAAACGAAAGUAAACU-UU

CUUCGGCCGCCGCGGGAGCCUGCCGCGUAGGACCUGAA-AGUAAGUGGUGCGCUCGGAUAUGGGGCAGGAAUUAAGCCAGCACGAACGUUAUGUGGAACA

AUUAAAACAGGCUUUAAAGACACGGGGAGUAAAGGUUAAAUAUGCUGAUCUCUUAAAGUUUUUUGAUUUUGUAAAGGAUACUUGUCCUU-3'

RS011467 (Simian retrovirus 2)

5'-UGGCGCCCAACGUGGGGCUGGAUACGAGGGAAUCCUGUGAGGAAGAGAGCGCG-UAACACGGCCGGCAGUCA-AAGUGAAAG-----AAAAACC-UU

CCA--GCUGCCGCGGGAACCUGCCGCGUCGG-CAAUAAAGGUAAGCGUUGCGUUCGAAUAUGGGACAAGAAUUAAGCCAACAUGAACUUUAUGUAGAACA

GUUAAAAAAGGCUCUAAAGACACGGGGAGUAAAGGUUAAGGGUAAUGAUUUACUCAAAUUCUUUGAUUUUGUAAAGGAUACCUGCCCUU-3'

RS011468 (Mason-Pfizer monkey virus)

5'-UGGCGCCCAACGUGGGGCUGGAUACGAGGGAAUUUCGUGAGGAAGACGACGCG-UUCGCCGGCCGGC-GAUUAAAAGUGAAAG-----UAAACUCUC

UU--GGCCGCCGCGGGAACCUGCCGCGUUGGACCU-GAAAGUAAGUGUUGCGCUCGGAUAUGGGGCAAGAAUUAAGCCAGCAUGAACGUUAUGUAGAACA

AUUGAAGCAGGCUUUAAAGACACGGGGAGUAAAGGUUAAAUAUGCUGAUCUUUUGAAAUUUUUUGAUUUUGUGAAGGAUACUUGUCCUU-3'

RS011469 (Simian retrovirus 2)

5'-UGGCGCCCAACGUGGGGCUGGAUACGAGGGAAUCCUGUGAGGAAGAGAGCGCG-UAACACGGCCGGCAGUCA-AAGUGAAAG-----AAAAACC-UU

CCA--GCUGCCGCGGGAGCCUGCCGCGUCGG-CAAUAAAGGUAAGCGUUGCGCUCAAAUAUGGGACAAGAAUUAAGCCAACAUGAACUCUAUGUAGAACA

AUUAAAAAAGGCUCUAAAGACACGGGGAGUAAAGGUUAAGGGUAAUGAUUUGCUCAAAUUCUUUGAUUUUGUAAAGGAUACCUGCCCUU-3'


References:

  1. Griffiths-Jones, S., Bateman, A., Marshall, M., Khanna, A., Eddy, S.R., RFam: an RNA family database, Nucleic Acids Research, 2003, 31, 1, 439-441.