English
Français

Database

Multiple Alignment

IDsAligned Sequences
Consensus structure

5'-..........................................................<<<<<<<<<<............<<<<<<.<<.......<

<<<.<<<<........>>>>....<<<<<<.....>>>>>>...>>>>.>>>>>>>>...............>>>>>>>>>>........-3'

 
RS010986 (Escherichia coli)

5'-CAAAA-GUCCCUGAAC--UCUCAAGCGAA-UCCGCAAUCAAAUAU-UCUGCCCAUG-CGGGGAAGGAUGAGAA-------GCUUCGACU---AAGGU

UCGGCUCGAGCGUCAGCGAGAGAGCGUUGCCGCAGGCAACGACCCGAAGGGCGAAGCGCGCAGCGCUGAGUAAUCCUUCCCCCACCACCA-3'

RS010987 (Escherichia coli)

5'-CAAAA-GUCCCUGAAC--UUCCCAACGAA-UCCGCAAUUAAAUAU-UCUGCCCAUG-CGGGGAAGGAUGAGAA-------GCUUCGACC---AAGGU

UCGACUCGAGCGCCAGCGAGAGAGCGUUGCCGCAGGCAACGACCCGAAGGGCGAAGCGCGCAGCGCUGAGUAAUCCUUCCCCCACCACCA-3'

RS010988 (Escherichia coli)

5'-CAAAA-GCCCCGGAAU--UCUCAAACGAA-UCCGCAAUCAAAUAU-UCUGCCCAAG-CGGGGAAGGAUGAGAA-------GCUUCGACC---AAGGU

UCGACUUGAGCGCCAGCGAGAGAGCGUUGCCGCAGGCAACGACCCGAAGGGCGAAGCGCGCAGCGCUGAGUAAUCCUUCCCCCACCACCA-3'

RS010989 (Escherichia coli CFT073)

5'-CAAAA-GCCCCUGAAU--UCUCAAACGAA-UCCGCAAUUAAAUAU-UCUGCCCAUG-CGGGGAAGGAUGAGAA-------GCUUCGACC---AAGGU

UCGACUCGAGUGCCAGCGAGAGAGCGUUGCCGCAGGCAACGACCCGUAGGGCGAAGCGCGCAGCGCUGAGUAAUCCUUCCCCCACCACCA-3'

RS010990 (Escherichia coli)

5'-C--AC-AGCGCAUGUG--GUAACUUCGGU-GAGAUUGUGAAAGUU-UGCACUCAU--CGGGGAAGGGUGAGAA-------CCUUCGACU---AAGGU

UCGAUUCGAGCGAAAGCGAGAGAGCGUUGCCACAGGCAACGGCCCGAA-GGUGAGGAGCGAAGCGACGAAUAAUCCUUCCCCCACCACCA-3'

RS010991 (Escherichia coli W3110)

5'-CACCACAGCGAUGUGG--UAAC-UUCGGUGAGAUUGUGAAAGUU--UGCACUCAU--CGGGGAAGGGUGAGAA-------CCUUCGACU---AAGGU

UCGAUUCGAGCGAAAGCGAGAGAACGUUGCCACAGGCAACGGCCCGAAGGGUGAGGAGCGAAGCGACGAAUAAUCCUUCCCCCACCACCA-3'

RS010992 (Salmonella enterica subsp. enterica serovar Typhi)

5'-CAA---GCAGCAUAAUGAAUUUAUCCCGU-GGUGGGGUUCCCGA--GCGGCCAAAG--GGAGCAGACUGUAAAUCUGCCGUCAUCGACUUCGAAGGU

UCGAUUCGAGCGC-AGCGAGAAAGCGUUGCCGUAGGCAACGACCCGAAGGGCGAAGCGCGCAGCGCUGAGUCAUCCUUCCCCCACCACCA-3'

RS010993 (Salmonella typhimurium LT2)

5'-CUCCC-GUCGCGUAUC--UUAUCCCCGUUAAGCACACUGUCUCAUAUCUCUCCGUA-C-GGGAAGGAUGAGAA-------GCUUCGACU---AAGGU

UCGAUUCGAGCGC-AGCGAGAACGCGUUGCCGCAGGCAACGACCCGAAGGGCGAAGCGCGCAGCGCUGAGUCAUCCUUCCCCCACCACCA-3'

RS010994 (Salmonella enterica subsp. enterica serovar Typhi)

5'-CAGAAAGCAUCU-AAC--CUUCAUUCGACAUCGGUUUGUCAUAAU-UCUACCCAUG-UGGGGAAGGAUGAGAA-------GCUUCGACU---AAGGU

UCGAUUCGAGCGAAAGCGAGAGAACGUUGCCGCAGGCAACGACCCGAAGGGCGAAACGCGCAGCGCUGAGUCAUCCUUCCCCCACCACCA-3'

RS010995 (Salmonella typhimurium LT2)

5'-CUCCC-GUCGCGUAUC--UUAUCCCCGUUAAGCACAGUGUCUCAUAUCUCUCUGUA-C-GGGAAGGAUGAGAA-------GCUUCGACC---AAGGU

UCGAUUCGAGCGC-AGCGAGAAAGCGUUGCCGCAGGCAACGACCCGAAGGGCGAAGCGCGCAGCGCUGAGUCAUCCUUCCCCCACCACCA-3'

RS010996 (Salmonella typhimurium LT2)

5'-CUUCC-GUCGCGUAUC--UUAUCCCCGUUAAGCAUAGUGUCUCAUAUCUCUCUGUA-C-GGGAAGGAUGAGAA-------GCUUCUACC---AGGGU

UCGAUUCGAGCGC-AGCGAGAAAGCGUUGCCGCAGGCAACGACCCGAAGGGCGAAGCGCGCAGCGCUGAGUCAUCCUUCCCCCACCACCA-3'

RS010997 (Salmonella typhimurium LT2)

5'-CACUACAGCGAUGUAG--UUA-ACUCGA--UGAGCAAUGCAGAAG-UUUGCACUUGUCGGGGAAGGGUGAGAA-------CCUUCGAUU---AAGGU

UCGACUCG------AGCGAAAGAACGUUGCCAACGGUAACGGCCCGUAGGGUGAGGAGUGAAGCGACGAAUAAUCCUUCCUCCACCACCA-3'

RS010998 (Salmonella typhimurium LT2)

5'-CUCCC-GUCGCGUAUC--UUAUCCCCGCUAAGCACAGUGCCUUAUAUCUCUCUGUA-C-GGGAAGGAUGAGAA-------GCUUCGACU---AAGGU

UCGAUUCGAGCGUCAGCGAGAAAGCGUUGCCGCAGGCAACGACCCGAAGGGCGAAGCGCGCAGCGCUGAGUCAUCCUUCCCCCACCACCA-3'

RS010999 (Shigella flexneri 2a str. 2457T)

5'-CAAAA-GCCCCGGAAU--UCUCAAACGAA-UCUGCAAUCAAAUAU-UCUGCCCAAG-CGGGGAAGGAUGAGAA-------GCUUCGACC---AAGGU

UCGACUUGAGCGCCAGCGAGAGAGCGUUGCCGCAGGCAACGACCCGAAGGGCGAAGCGCGCAGCGCUGAGUAAUCCUUCCCCCACCACCA-3'

RS011000 (Yersinia pestis KIM)

5'-AAUAU-CUCCCU-CUC--CCAAAUAC-AC-UAAGCAAUAAAAUAG-UUCUCAUAUC-UGGGGAAGG-UAAGAA-------CCUUCGAC----AAGGU

UCGCGCCGAGCGU-AGCGAGACAACGACGC--AAAGCGGCGGCCCGAAGGGUGAGGAACGCAGUGACGAAUAAUCCUUCCCCCACCACCA-3'

RS011001 (Yersinia pestis KIM)

5'-AAUAAUAUCUCU-CUC--UCCCAAAUACACUAAGCAAUAAAAUAG-UUCUCAUAUC-UGGGGAAGG-UAAGAA-------CCUUCGAC----AAGGU

UCGCGCCGAGCGU-AGCGAGACAACGACGC--AAAGCGGCGGCCCGAAGGGUGAGGAACGCAGUGACGAAUAAUCCUUCCCCCACCACUA-3'


References:

  1. Griffiths-Jones, S., Bateman, A., Marshall, M., Khanna, A., Eddy, S.R., RFam: an RNA family database, Nucleic Acids Research, 2003, 31, 1, 439-441.