English
Français

Database

Multiple Alignment

IDsAligned Sequences
Consensus structure

5'-.................<<<<<<<<<.......>>>>>>>>>.................<<<.<<.......>>.>>>...................

...<<<.................................<<<<<....>>>>>.......>>>.......<<<<<<<<<<<<<..>>>>>>>>>>>>>..

...........-3'

 
RS005250 (Escherichia coli)

5'-ACGAUCGAUAUCUAUUUUAUCGAUCGUUUAUAUCGAUCGAUAAGCUAAUAAUAACCUUUGUCAGUAACAUGCACAGAUACGUA--CAGA-AAGACAU

UCAGGGAACAACAGAACCACAAUUCAGAAACUCCCA-CAGCCGGACCUCCGGCACUGUAACCCUUUACCUGCCGGUAUCCACGUUUGUGGGUACCGGCUU

UUUUAUUCACC-3'

RS005251 (Escherichia coli)

5'-ACGAUCAAUAUCGAUUUAAUCGAUCGUUUAUAUCGAUCGAUUAGCUAAUAAUAACCUUUGUCAGUAACAUGCACAGAUAUGUUACCAGA-AAGACAU

UCCGGGAACAACAGAACCACAAUUCAGAAAUUCCCA-CAGCCGGACCUCCGGCACUGUAACCCUUUACCUGCCGGUAUCCACGUUUGUGGGUACCGGCUU

UUUUAUUCACC-3'

RS005252 (Escherichia coli CFT073)

5'-ACGAUCGAUAACUAUUUAAUCGAUCGUUUAUAUCGAUCGUUAUGCUAAUAAUAACACCCGUUAGCAAUGUAUGCAGA--CACA--CAGACAUGAGAU

UCAGGGAACAACAGAGCCACACGUCAGAAACUUCCAUCAGCCGGAUCUGCGGCACUGUAACCCUUCACCUGCAGGUAUCCACAUUUGUGGAUACCGGCUU

UUU-AUUCACC-3'

RS005253 (Escherichia coli CFT073)

5'-ACGAUCAAUACCUAUUUUACCGAUCGUUAAUAUCGAUCGUUAUGCUAAUAAUAACUCCUGUUAGCAACGUGCGCAGAUACACA--CAGACAUGAGAU

UCAGGGAACAACAGAGCCACACGUCAGAAACUUCCGUCAGCCGGACCUCCGGCACUGUAACCCUUUACCUGCCGGUAUCCACAUCUGUGGAUACCGGCUU

UUUUAUUCACC-3'

RS005254 (Escherichia coli W3110)

5'-ACGAUCAAUAUCUAUUUUAUCGAUCGUUUAUAUCGAUCGAUAAGCUAAUAAUAACCUUUGUCAGUAACAUGCACAGAUACGUA--CAGA-AAGACAU

UCAGGGAACAACAGAACCACAAUUCAGAAACUCCCA-CAGCCGGACCUCCGGCACUGUAACCCUUUACCUGCCGGUAUCCACGUUUGUGGGUACCGGCUU

UUUUAUUCACC-3'

RS005255 (Escherichia coli)

5'-ACGAUCGAUACCUAUUUCACCGAUCGUUAAUAUCGAUCGUUAUGCUAAUAAUAACUCAUGUUAGCAACGUGCGCAGAUACACA--CAGUCAUGAGAU

UCAGGGAACAACAGAGCCACACGUCAGAAACUUCCGUCAGCCGGACCUCCGGCACUGUAACCCUUUACCUGCCGGUAUCCACAUCUGUGGAUACCGGCUU

UUUUAUUCACC-3'

RS005256 (Shigella flexneri 2a)

5'-ACGAUCGAUACCUAUUUUACCGAUCGUUAAUAUCGAUCGUUAUGCUAAUAAUAACUCCUGUUAGCAACGUGCGCAGAUACACA--CAGACAUGAGAU

UCAGGGAACAACAGAGCCACACGUCAGAAACUUCCGUCAGCCGGACCUCCGGCACUGUAACCCUUUACCUGCCGGUAUCCACAUCUGUGGAUACCGGCUU

UUUUAUUCACC-3'


References:

  1. Griffiths-Jones, S., Bateman, A., Marshall, M., Khanna, A., Eddy, S.R., RFam: an RNA family database, Nucleic Acids Research, 2003, 31, 1, 439-441.