English
Français

Database

Multiple Alignment

IDsAligned Sequences
Consensus structure

5'-...<<<<<<<....<<<<<<<<<..........>>>>>>...<<<<....>>>><<<<<<<.......>>>>>>>.......<<<<<<.......>>

>>>>.>>>>>>>>.>>.-3'

 
RS005248 (Escherichia coli)

5'-CUUACUGAGAGCACAAAGUUUCCCGUGCCAACAGGGAGUGUUAUAACGGUUUAUUAGUCUGGAGACGGCAGACUAUCCUCUUCCCGGUCCCCUAUGC

CGGGUUUUUUUUAUGUC-3'

RS005249 (Escherichia coli)

5'-CUUACUGAGAGCACAAAGUUUCCCGUGCCAACAGGGAGUGUUAUAACGGUUUAUUAGUCUGGAGACGGCAGACUAUCCUCUUCCCGGUCCCCUAUGC

CGGGUUUUUUUUAUGUC-3'


References:

  1. Griffiths-Jones, S., Bateman, A., Marshall, M., Khanna, A., Eddy, S.R., RFam: an RNA family database, Nucleic Acids Research, 2003, 31, 1, 439-441.